J. Gen. Appl. Microbiol., 48, 293–297 (2002)

phic yeasts characterized by the production of arthroconidia. Twenty-six species have been listed in the genus Trichosporon, which includes medically relevant species that cause opportunistic infections and induce summer-type hypersensitivity pneumonitis (SHP) (Ando et al., 1995; Guého et al., 1994, 1998; Middelhoven et al., 1999, 2000a, b; Sugita et al., 2001). Besides pathogens, Trichosporon species are widely distributed in the environment, and are also used as a biological sensor in industry to determine biochemical oxygen demand (Yang et al., 1996). While analyzing the diversity of Trichosporon in the soil, we found a new Trichosporon species. In this paper, we propose a new species, Trichosporon terricola sp. nov., for the isolates. Strains M9900, M9952, and M9953 used in this study were isolated in July 1997 from soil in Niiza, Saitama, Japan. Most of their morphological, biochemical, and physiological characteristics were examined using the methods described by Yarrow (1998). Their biochemical characteristics were also investigated using ID32C (bioMérieux SA, Marcy I’Etoile, France) in accordance with the manufacturer’s instructions. Ubiquinone molecules were identified according to the method of Nakase and Suzuki (1986). The DNA base composition (mol% G C) was determined by nucleotide analysis, using HPLC after digesting the DNA with Nuclease P1 (Yamasa Shouyu, Chiba) as described by Tamaoka and Komagata (1984). Xylose was detected in cell wall polysaccharides by gas chromatography as previously described by Sugita et al. (2001). The internal transcribed spacer (ITS) regions (Sugita et al., 1999), D1/D2 regions of 26S rDNA (Kurtzman and Robnett, 1997), and intergenic spacer (IGS) 1 region (Sugita et al., 2002) were determined directly using PCR products with primers: pITS-F (5 GTCGTAACAAGGTTAACCTGCGG) and pITS-R (5 TCCTCCGCTTATTGATATGC), NL-1 (5 -GCATATCAATAAGCGGAGGAAAAG) and NL-4 (5 -GGTCCGTGTTTCAAGACGG), and 26SF (5 -ATCCTTTGCAGACGACTTGA) and 5SR (5 -AGCTTGACTTCGCAGATCGG), respectively, using an ABI 310 DNA sequencer A basidiomycetous anamorphic yeast, Trichosporon terricola sp. nov., isolated from soil